Talk:Homologous recombination
| Homologous recombination has been listed as one of the Natural sciences good articles under the good article criteria. If you can improve it further, please do so. If it no longer meets these criteria, you can reassess it. | |||||||||||||||||||||||||
| |||||||||||||||||||||||||
| This It is of interest to the following WikiProjects: | |||||||||||||||||
| |||||||||||||||||
|
This article contains broken links to one or more target anchors:
The anchors may have been removed, renamed, or are no longer valid. Please fix them by following the link above, checking the page history of the target pages, or updating the links. Remove this template after the problem is fixed | Report an error |
Introduction
editThe introduction does not actually say what HR is. ie. no summary explanation. —Preceding unsigned comment added by 99.234.154.88 (talk) 19:33, 20 April 2009 (UTC)
- Could you be more specific on how you think the introduction could be improved? The first sentence notes that HR "is a type of genetic recombination in which genetic material is exchanged between two similar or identical strands of DNA", which is a high-level definition of what HR actually is. Thanks, Emw2012 (talk) 19:43, 20 April 2009 (UTC)
Reference to Add
editI do not know how to add a reference, but would add "Molecular Biology of the Gene, Fifth Edition" by James D. Watson, et al. I started to add it, but it seemed like a mess, so I left it out.
I would add this article also: http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=18022364
It discusses how RecD appears only to be inactivated, not lost from the complex. It has some important information for the RecBCD articles, as well. —Preceding unsigned comment added by RegiG (talk • contribs) 02:01, 1 July 2008 (UTC)
Suggestions
editHello, I have a few suggestions to help improve this article. First, though, big thanks to Emw2012 for all his recent work on this article. I've been watching these edits and the improvement is really remarkable! Here are my suggestions:
- More detailed information on the roles of the eukaryotic recombination proteins, similar to the discussion of the bacterial proteins in the article. A good place to start could be the biochemical roles of the Rad52 epistasis group in yeast, and then move on to mammalian proteins.
- The mechanism of 5' end resection has recently been elucidated and should be in this article. Here is a good review. I think this would also be a good place to talk about regulation of the choice between recombination and non-homologous end joining for double-strand break repair.
- A section on the single-strand annealing pathway should be added.
- Holliday junction resolvases should be discussed, in particular the recent series of papers on Slx1-Slx4 that came out in Cell and Molecular Cell in July.
I will help with some of this if I get a chance. Amazinglarry (talk) 02:29, 24 August 2009 (UTC)
- Thanks for your suggestions, and your compliment. I agree that the 'In eukaryotes' section would benefit from giving more attention to specific proteins and their role. I've also had an explanation of post-synapsis steps of bacterial and eukaryotic recombination on the backburner; I will give that attention along with your other suggestions. I'm very appreciative to have someone with significant experience in DNA repair research giving feedback on the article. Emw2012 (talk) 04:14, 24 August 2009 (UTC)
Context of ocurrence
edit"The World of the Cell", introductory book on Cell biology, ISBN 978-0-321-55418-5, Pearson/BenjaminCummings, mentions on page 627 five different situations in which hom. rec. occurs: 1) Two different phages infect the same bacterium 2) Uptake of raw DNA in bacteria (transformation) 3) Systematic transfer of genetic material (plasmids) between bacteria (conjugation) 4) Prophase I 5) Transfer of bacterial genes between bacteria by incorporation in virus (phage) (transduction). The present article mentions meiosis and mitosis. This seems rather incomplete. --Ettrig (talk) 07:19, 7 September 2009 (UTC)
- Transformation is pretty much covered in the gene targeting section, and the other 3 (conjugation, transduction, 2 phages) could be added in a couple sentences in the "In bacteria" section. They're probably worth a mention for historical reference, but maybe try to keep it short since phage is not used as a model system for genetics much any more. I don't think many people are going to come to this article looking for phage stuff. Amazinglarry (talk) 12:15, 7 September 2009 (UTC)
- Outdated research. Interesting. The book is copyrighted 2009. But aren't transfer by virus and recombination of viruses important for evolution and humankind, e.g. in creating new influenzae strains? --Ettrig (talk) 12:52, 7 September 2009 (UTC)
- Regarding transformation, conjugation etc., I've tried to address these with the "Horizontal gene transfer" subsection of "In bacteria". I'll augment the section and mentioned the particular types of HGT since the target audience may not take note of HR's role in them otherwise. I think it would also be good to at least briefly discuss the relationship between HR and viral reassortment, which you've alluded to. Emw2012 (talk) 13:45, 7 September 2009 (UTC)
- But when reading reassortment I get the impression that this is not HR, so there is no relation? --Ettrig (talk) 14:15, 7 September 2009 (UTC)
- You're right -- I had a misunderstanding about reassortment that was cleared up by the explanation here. Homologous recombination in viruses seems to be the subject of at least a few papers (e.g. this paper and several articles citing it). I agree that viral HR should be discussed in the article. Emw2012 (talk) 17:20, 10 September 2009 (UTC)
- But when reading reassortment I get the impression that this is not HR, so there is no relation? --Ettrig (talk) 14:15, 7 September 2009 (UTC)
- Regarding transformation, conjugation etc., I've tried to address these with the "Horizontal gene transfer" subsection of "In bacteria". I'll augment the section and mentioned the particular types of HGT since the target audience may not take note of HR's role in them otherwise. I think it would also be good to at least briefly discuss the relationship between HR and viral reassortment, which you've alluded to. Emw2012 (talk) 13:45, 7 September 2009 (UTC)
- Outdated research. Interesting. The book is copyrighted 2009. But aren't transfer by virus and recombination of viruses important for evolution and humankind, e.g. in creating new influenzae strains? --Ettrig (talk) 12:52, 7 September 2009 (UTC)
Model bacteria
editThe article currently says "Studies in several model bacteria ...". Is "model" valuable here? I think the normal use of "model" in contexts like these is used to signal that one really is interested in studying a mechanism in the human body, but studying the corresponding mechanism in another organism instead, in the hope that the mechanism in the other organism is sufficiently similar to the human one. This article is not specifically about human HR. --Ettrig (talk) 16:13, 10 September 2009 (UTC)
I find that model is used extensively in the article. I think this is because medical research is such a large part of melecular biology research. Possibly the meaning of this expression has changed in the modern context, from used to provide "insight into the workings of other organisms", as Model organism says, to used to provide insight into a particular mechanism, subsystem etc. But for the time being we should stick to the Wikipedia description of the concept. --Ettrig (talk) 16:23, 10 September 2009 (UTC)
- While the article isn't exclusively about human HR, I don't think the use of "model" throughout is unwarranted. Research in bacterial HR is often done with the assumption that findings there will at least somewhat transfer to understanding of human HR -- this is evidenced by various societies for eliminating cancer funding research in bacterial HR, for example. Since they can reveal how many aspects of HR mechanisms work in other organisms, including us, bacteria can indeed be model organisms. With regard to a distinction between "workings" and "mechanisms", I don't see how there's much of a difference, if any. Consider the list of bacteria in the article on model organisms. It is precisely because they reveal information about low-level biological phenomena (e.g., HR) applicable to other organisms that those bacteria are considered model organisms. The listing for E. coli contains more or less the wording you removed. Looking at RNAi, another featured article on a mechanism in molecular biology, I don't see how this article differs in appending "model" to various organisms. Emw2012 (talk) 17:04, 10 September 2009 (UTC)
- I think you're reading a little too much into the phrase, Ettrig. Pretty much any organism used frequently in research is called a "model organism" or referred to as a "model system." It's just a phrase, it's not meant to imply that studying a non-human organism for reasons other than gaining insight into human biology is somehow unimportant. Amazinglarry (talk) 00:36, 11 September 2009 (UTC)
- I agree, if for example we are studying HR in E. coli, then it is a model organism for (from least to greatest specificity) HR in general, HR in bacteria, HR in gram negative bacteria, HR in Enterobacteriaceae, and the strain your studying is a model for other E. coli strains. Gobbits (talk) 06:56, 18 May 2015 (UTC)
Bacterial Transformation
editI think that the section needs to be significantly streamlined, it has a lot of unnecessary information, and it doesn't have any sources for half the things it says. Gobbits (talk) 07:02, 18 May 2015 (UTC)
Protein engineering
editFor starters, this is a nice article! In the Protein Engineering section, we might consider adding links to DNA shuffling, RACHITT and other similar articles. However, those two articles I mentioned are in need of attention. Pdcook (talk) 17:03, 18 September 2009 (UTC)
Editorial
editthe intro says These new combinations of DNA produce genetic variation. This is grammatically wrong. The process of recombination produces genetic variation. The combinations themselves ARE the genetic variation. The article is so well formulated in general, that I dare not make the corrections myself. In my opinion it is overdue for the GA stamp. --Ettrig (talk) 16:00, 21 September 2009 (UTC)
- Good point. I've changed 'produce' to 'represent', and tweaked the rest of the sentence for flow. Emw2012 (talk) 17:28, 21 September 2009 (UTC)
Comments by Cryptic C62
editHere are some comments on the article's prose:
Resolved comments |
|---|
|
Unresolved issues
edit- "SDSA is completed with the removal of 3' flaps" What does "flap" refer to in this context? I would be satisfied with a wikilink, but I didn't see any helpful articles at flap.
- I don't think 3' flaps are notable enough to warrant a separate article. I've added some explanation. (If the reader understandably struggles to visualize this concept, 3' flaps are shown in Step 4 of the animation in Figure 5.) Emw (talk) 02:39, 9 July 2010 (UTC)
- Hrm, the animation doesn't seem to be working. Are you certain that you uploaded the file correctly? --Cryptic C62 · Talk 20:06, 12 July 2010 (UTC)
- Yes, the file was uploaded correctly. MediaWiki's support for SVG isn't good, and its support for animated SVG is worse. The user must click once to access to the 'File page' -- which has a PNG rendering of the static SVG -- then click that rendering to access the underlying SVG file. That SVG file only renders as an animation in browsers that support animated SVG, or SMIL; this is indicated in the caption of Figure 5. The static PNG rendering of the animated SVG is a tolerable substitute for browsers that don't support the format -- Firefox and IE. For browsers that do support animated SVG -- Chrome, Opera and Safari -- using the format is a substantial aid in visualization. Firefox 4 beta natively supports animated SVG, and upon its public release in Q4 2010 will significantly increase the share of users with easy access to this animation. I believe the current IE9 beta also supports animated SVG, although not flawlessly. Emw (talk) 02:56, 14 July 2010 (UTC)
- More than 80% use Internet Explorer or Firefox, meaning the vast majority of our readers won't be able to see the animation. Perhaps Animated PNG or Animated GIF would be a better choice in terms of WP:ACCESSIBILITY. --Cryptic C62 · Talk 16:36, 15 July 2010 (UTC)
- I don't think an animated PNG and or GIF would be an adequate substitute for the SVG animation in question. The length of the animation would make the file size of an animated PNG/GIF version much larger than the current SVG version. Also, infinite loops of animated PNG/GIFs can be quite distracting. While the animation won't be accessible to everyone, and this is unfortunate, I don't see anything in WP:ACCESSIBILITY particularly relevant to this issue. While about 80% of users don't have native support for animated SVG, over 50% don't use browsers with native support for Ogg Theora, MediaWiki's only supported video format. If I were to change the format (or make new animations), I would consider Ogg Theora if not SVG. Because the animation is informative even as a still frame, I think the use of animated SVG can be considered a progressive enhancement for users with support. Emw (talk) 23:20, 17 July 2010 (UTC)
- I strongly disagree that the animation is informative as a still frame. As someone who knows very little about cell bio and as someone who has never seen the animation and can't imagine what it might look like, the still frame provides no new information of any kind. Why not simply employ a step-by-step diagram like in Figure 7? --Cryptic C62 · Talk 12:12, 20 July 2010 (UTC)
- The still frame has a list of steps which reinforce the pathway's description in the text, and also shows the positioning of repeat elements in DNA. Given that, I think the still frame is somewhat informative, although not as informative as the animation, thus making the animation a progressive enhancement. If I have time, I may create an animated SVG which shows a more comprehensive still-frame after being processed by MediaWiki. Emw (talk) 11:54, 23 July 2010 (UTC)
- "The pathways are also similar in their phases of branch migration, in which the Holliday junction slides in one direction," I'm not sure what the intended meaning of "slides in one direction" should be. Is it ever possible for an object to slide in multiple directions? :P
- Branch migration can be toward the 3' end or the 5' end, so the phrase 'in one direction' is not extraneous. In my opinion it is also not useless detail for the lay person; it helps somewhat to visualize the process. A diagram here would be especially helpful. Emw (talk) 11:54, 23 July 2010 (UTC)
- Perhaps the 3'/5' bit can be stated explicitly: "The pathways are also similar in their phases of branch migration, in which the Holliday junction slides towards the 3 end or the 5' end" --Cryptic C62 · Talk 14:17, 27 July 2010 (UTC)
- "The RecBCD enzyme promotes recombination after DNA" What does "promotes" mean in this context?
- "There is controversy over whether homologous recombination occurs in negative-sense ssRNA viruses like influenza" I don't think that "controversy" is the best word here. Perhaps "There is not yet consensus..." would work better.
- "For example, if the genomes of two viruses with different disadvantageous mutations undergo recombination, then they may be able to regenerate a fully functional genome" This is somewhat confusing because there is a contrast between "disadvantageous" and "fully functional", which are not really opposites. Having a disadvantageous mutation doesn't imply that the genome is dysfunctional. Not sure how you would want to address this.
- Caption: "Protein domains in homologous recombination-related proteins are conserved across the three main groups of life: archaea, bacteria and eukaryotes." I assume the list was ordered alphabetically or chronologically, but I think it would make more sense to list them in the same order as they appear in the diagram: bacteria, eukaryotes, archaea. Alternatively, the diagram could be rearranged to match the current list order.
I will add comments here as I go through the article. As you address issues, please respond beneath the individual concerns above so that I know which are done and which require further discussion. Thanks! --Cryptic C62 · Talk 02:26, 24 June 2010 (UTC)
- Thank you for the continued input! What are your thoughts on moving these comments into the FAC review? I see two benefits: 1) it would make it easier in the future to find the reviews for this FAC, and 2) it would inform potential FAC reviewers and the FAC delegates that reviews are still ongoing. Emw (talk) 06:07, 8 July 2010 (UTC)
- I used to leave all of my comments on the FAC page, but doing so created two problems which were easily solved by leaving them on the talk page instead: the first is that leaving so many comments can clutter up the FAC page and also bog down the main listing at WP:FAC. The second is that if the FAC closes (successful or not) before I finish my review, I can continue working with the author without having to edit an archived page. The other reason that I personally prefer leaving comments on talk pages is that it opens up the discussion to other interested editors who may not be familiar with the FAC process. As for your concern about keeping the FAC delegates informed, don't worry about it. User:Karanacs and I have been through this song and dance many times before. As long as it's clear that the author (you) is committed to addressing my nitpicks (which is obviously the case here), she won't close the FAC as unsuccessful just because I go through articles like a snail through molasses. --Cryptic C62 · Talk 18:29, 8 July 2010 (UTC)
Review discontinued due to inactivity. If anyone is interested in continuing, feel free to leave a message on my talk page. --Cryptic C62 · Talk 15:00, 23 August 2010 (UTC)
Comments by Colin
editThe lead generally does a very good job. I can't comment on whether it is comprehensive but it is fairly accessible to a lay reader. However, lead terms that may not be understood are: homologous, eukaryotes, protists, eukaryotic, conserved. If you can make those accessible, you stand a chance of keeping the reader beyond the lead!
- I've given an example of eukaryotes, and briefly defined protists. I think readers will make the connection between 'eukaryote' and 'eukaryotic'. I also think 'conserved' is close enough to its general meaning to be understood at a basic level by lay readers. In the lead caption, I've changed 'homologous' to 'similar but not identical'. Emw (talk) 00:31, 27 June 2010 (UTC)
History:
Once the reader gets past the lead, the first sentence he gets in the history is "Following the discoveries made by Gregor Mendel, it was shown that genes are often linked and do not segregate randomly." This is a bit off putting because it assumes the reader knows what "discoveries" Mendel made. The average reader will connect Mendel with genetics but this is a very advanced genetic topic so will wonder if there's some specific discovery they should know about. I think you need to explain "linked" and "segregate". The latter could also be linked to the appropriate bit in Mendelian inheritance perhaps.
- Good point. I've revised that paragraph in light of your comments. Emw (talk) 00:31, 27 June 2010 (UTC)
The sentence "Thomas Hunt Morgan introduced the term "crossing over"" doesn't explain what he introduced the term for. It gives an explanation later in the sentence but says this was "shown later" which begs the question why he introduced the term if he didn't know what it meant.
- I've addressed this point in my revision. Emw (talk) 00:31, 27 June 2010 (UTC)
This is such a complex subject that you might need to re-explain jargon that is already explained in the lead. So it probably does no harm to explain meiosis and you haven't yet explained mitosis.
- Meiosis has now been explained, and I've added some context to mitosis. Emw (talk) 00:31, 27 June 2010 (UTC)
Hans Winkler's "gene conversion" term is not defined. I'm beginning to wonder if the History can only be understood once you've read the article. The "Holliday junctions", "DSBR pathway" and "SDSA pathways" aspects won't really mean anything to the reader at this stage, so they can't really grasp why these discoveries are relevant.
- I've removed the reference to Winkler, and added context on what Holliday junctions are and thus why Holliday's model matters. While the reader likely won't know much about the DSBR and SDSA pathways, I give them some context and wikilink the specific sections. This also is a bridge that leads the reader into the next section which discusses the pathways in more detail. Emw (talk) 00:31, 27 June 2010 (UTC)
I think the gene targeting sentence "In recognition...2007 Nobel Prize" belongs in this section, not the gene targeting section. I wonder also if some aspects of the cancer therapy is notable enough to appear in the history.
- I'd like to prevent the 'History and discovery' section from becoming another lead. Gene targeting and cancer therapy are applications and aren't particularly relevant in terms of historical context of the discovery of homologous recombination. Emw (talk) 00:31, 27 June 2010 (UTC)
In eukaroytes:
You need to define "eukaroytes". My comments on explaining mitosis/meiosis may apply here if the History section is moved. Define "somatic cells".
- I prefer not to move the History section. Although it's been given more context in the lead, I've also now defined eukaryotes by listing example organisms here. (I don't think it's necessary to redefine what a protist is in that list.) In my rework of the History section I've also defined 'somatic cells' by example. Emw (talk) 00:31, 27 June 2010 (UTC)
The sentence "Chromosomal crossover begins when the Spo11 protein makes a..." is written with the assumption that the reader knows the Spo11 protien and is best friends with its brother. I'm guessing at this stage that I don't need to know much about Spo11 other than what it does here. You can help me feel less ignorant my saying "begins when a protein called Spo11 makes a...". I'm guessing that "programmed" means "deliberate"?
- Changed phrase to "...begins when a protein called Spo11 makes a targeted...". Emw (talk) 00:31, 27 June 2010 (UTC)
"1,000-2,000 base pair regions of chromosomes" I know what "base pairs" are (well, vaguely) but the general reader wont. They might not appreciate that this appears to be a description of the size of the regions. Should it be "in chromosomes"?
- I've now wikilinked base pair and rearranged the phrase to indicate it's referring to a description of length. Emw (talk) 00:31, 27 June 2010 (UTC)
"by the phase of cell cycle" Ok I'm beginning to get lost. Can you give me a brief introduction to the "cell cycle" and the phases. The diagram on the right needs the key from Cell cycle otherwise it isn't telling me anything.
- I've added some context to indicate what the cell cycle is. Also, in the diagram caption, I've added some material to help readers understand what the S, G2 and M phases are. I think the expanded caption, which is more or less duplicated in the section's body, along with the new brief context on what the cell cycle is, now give the lay reader enough background to get a fair handle of what's going on. I think an expanded introduction to the cell cycle could bring the section off-topic. Emw (talk) 13:32, 27 June 2010 (UTC)
"Cyclin-dependent kinases (CDKs), which modify" I don't know what kinases are never mind Cyclin-dependent ones. Looking up WP, I see they are enzymes. Could we say something like "Homologous recombination in eukaryotes is regulated by cyclin-dependent kinases (CDKs), enzymes that modify the activity of other proteins by adding phosphate groups to them (known as phosphorylation)."
I don't know what "endonuclease activity" is. Or what the MRX complex is.
- Is "endonuclease activity" not indicated sufficiently by the context? It means that Sae2 cuts DNA. Technically, that Sae2 cuts within the DNA, but I think noting this detail may bog readers down more than inform them. I've moved the brief definition of the MRX complex up a section. Emw (talk) 00:31, 27 June 2010 (UTC)
"a homolog of the bacterial RecQ helicase discussed above" The RecQ helicase is discussed below. So I can't follow this and I don't know what a helicase is.
- Helicase is defined in the next sentence. I've removed the bit about homology to the RecQ helicase. Emw (talk) 00:31, 27 June 2010 (UTC)
dead link
editThis article has a dead link (ref 2) MacDaid (talk) 18:28, 26 June 2010 (UTC)
- Thanks, fixed. Emw (talk) 00:55, 27 June 2010 (UTC)
File:RecBCD recomb model.tif Nominated for speedy Deletion
editAn image used in this article, File:RecBCD recomb model.tif, has been nominated for speedy deletion at Wikimedia Commons for the following reason: Copyright violations
Don't panic; deletions can take a little longer at Commons than they do on Wikipedia. This gives you an opportunity to contest the deletion (although please review Commons guidelines before doing so). The best way to contest this form of deletion is by posting on the image talk page.
To take part in any discussion, or to review a more detailed deletion rationale please visit the relevant image page (File:RecBCD recomb model.tif) This is Bot placed notification, another user has nominated/tagged the image --CommonsNotificationBot (talk) 11:49, 27 March 2012 (UTC) |
- I nominated this image for deletion because it seems to have been a screenshot of Figure 1B from Genes Dev. 2007 December 15; 21(24): 3296–3307. The image is Copyright © 2007, Cold Spring Harbor Laboratory Press. Source: http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2113030/figure/F1/. I've removed the figure (Figure 7A) and its caption from this article. This shouldn't affect the article much, since the figure was largely redundant with Figure 7B (now Figure 7). Emw (talk) 16:15, 27 March 2012 (UTC)
LESS COMPLEMENT: сanon structura of cross-siments of DNA
TTAACAGGATACCCGATCTAGCCGCAAGCATACTTGACC
TTAACAGCATACTTGACC
TTAACAGGATACCCGATCTAGCCGCAAGCATACTTGACCTAGCCGCAAGCATACTTGACC
TTAACAGGATACCCGATCTAGCCGCAAGGATACTTGACCTAGCCGCAAGCATACTTGACC
and TTAACAGGATACCCGATCTAGCCGCAAGCATACCCGATCTAGCCGCAAGCATACTTGACC
--WITH THISE is quazi COMPLEMENT---
AATTGTCCTATGGGCTAGATCGGCGTTCCTATGGGCTAGATCGGCGTTCGTATGAACTGG
(of Book Singer&Berg Genes and Genomes) total line of the programm searh =20.THE END for thise Quston, ALL comments dont not living!!тишина!
difficulty with </ref>
editI have tried multiple times to insert a reference correctly at the end of the section on viruses. My reference works perfectly in my sandbox. I have tried using Wikipedia template filling to make sure I did it correctly, but I get the same error each time, Cite error: A [1] (see the help page).Chaya5260 (talk) 23:39, 8 December 2013 (UTC)
- ↑ tag is missing the closing
Proposed split out of Effects of dysfunction section to Homologous recombination deficiency
editThis is a big topic now in ovarian cancer, and as a target of PARP inhibitor drugs. - Rod57 (talk) 13:10, 30 December 2016 (UTC)
- @Rod57: No response for a few years and the section is small and fits here. I would suggest that if you are interested and there is enough notability then you can create the article yourself. AIRcorn (talk) 03:46, 31 March 2018 (UTC)
Recombination: biased or not fragmentation segments/fragments
editOne big issue is if the fragmentation places exhibit some bias (not necessarily absolute but regional), and that opens the path to more questions (if epigenetic changes have an impact on the patterns of recombinant fragmentation).
It doesn't have to happen all the time and at exact places; even small biases play a huge role in millions of years of evolution.
We need more data. — Preceding unsigned comment added by 2A02:587:4104:99BE:B1CD:5E5B:5D0B:33E4 (talk) 01:37, 22 October 2020 (UTC)
Reference links to WHO Bulletin: 1 July 2021
editRef 102 (Viral transmission and evolution dynamics of SARS-CoV-2 in shipboard quarantine) was the correct reference for what was being claimed, with correct name and authorship, but all links went to the subsequent paper from the same journal (Specifically a paper about use of an alcohol screening tool in Russia)
While it was an easy fix, other uses of the same source on different pages, probably should be checked, to see if this is a systemic issue due to the journal readdressing or incorrectly addressing their DOIs initially, or if this is a one time issue. — Preceding unsigned comment added by PewterPenguin (talk • contribs) 04:41, 27 December 2021 (UTC)
Update:
https://en.wikipedia.org/wiki/Coronavirus_3%E2%80%B2_stem-loop_II-like_motif_(s2m) Fixed
https://en.wikipedia.org/wiki/COVID-19_pandemic_on_Diamond_Princess Fixed
https://en.wikipedia.org/wiki/Diamond_Princess_(ship) Fixed
https://zh.wikipedia.org/wiki/%E9%91%BD%E7%9F%B3%E5%85%AC%E4%B8%BB%E8%99%9F Fixed
All found to have the exact same issue, suggesting systemic issue. WHO Bulletins should probably be watched in the future for changes in links. — Preceding unsigned comment added by PewterPenguin (talk • contribs) 04:51, 27 December 2021 (UTC)

